negative control (nc) mimics (Shanghai GenePharma)
90
Structured Review
Shanghai GenePharma
negative control (nc) mimics
Negative Control (Nc) Mimics, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+(nc)+mimics/mimic+negative+control/pm40682848-30-110-182
Average 90 stars, based on 1 article reviews
Negative Control (Nc) Mimics, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+(nc)+mimics/mimic+negative+control/pm40682848-30-110-182
Average 90 stars, based on 1 article reviews
negative control (nc) mimics - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Control:Article Title: Mechanism of microRNA-152 Regulating Decidual Natural Killer Cell Viability and Affecting Trophoblast Cell Invasiveness via the HLA-G/KIR2DL4 Axis. Article Snippet: The cells were cultured in Roswell Park Memorial Institute- 1640 (RPMI- 1640) medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) at 37°C with 5% CO2. .. HTR- 8/SVneo cells were grouped as below: the Control group (untreated cells), mimics NC group (HTR- 8/SVneo cells transfected with mimics NC for 48 h), miR- 152 mimics group (HTR- 8/ SVneo cells transfected with miR- 152 mimics for 48 h), Transfection:Article Title: Mechanism of microRNA-152 Regulating Decidual Natural Killer Cell Viability and Affecting Trophoblast Cell Invasiveness via the HLA-G/KIR2DL4 Axis. Article Snippet: The cells were cultured in Roswell Park Memorial Institute- 1640 (RPMI- 1640) medium (Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) at 37°C with 5% CO2. .. HTR- 8/SVneo cells were grouped as below: the Control group (untreated cells), mimics NC group (HTR- 8/SVneo cells transfected with mimics NC for 48 h), miR- 152 mimics group (HTR- 8/ SVneo cells transfected with miR- 152 mimics for 48 h), other:Article Title: The miR-192/EGR1-HOXB9 loop inhibits immune evasion in glioma by arresting their NSC phenotypes. Article Snippet: Objective: To elucidate the mechanism by which the miR-192-related axis regulates glioma immune evasion.. Methods: Factor expression was measured by PCR/Western Blotting (WB).. Immunofluorescence, FISH and DLRTM were used to elucidate target regulation mechanisms. Article Title: Combined miR-181a-5p and Ag Nanoparticles are Effective Against Oral Cancer in a Mouse Model Article Snippet: The expression of Article Title: miR-183-5p-enriched extracellular vesicles promote the crosstalk between hepatocellular carcinoma cell and endothelial cell via SIK1/PI3K/AKT and CCL20/CCR6 signaling pathways Article Snippet: Based on the experimental requirements, miR-183-5p mimics/NC or Article Title: MEIS1‑regulated miR‑488‑3p suppresses the malignant progression of laryngeal squamous cell carcinoma by targeting ACVR1C. Article Snippet: All cells were cultured at 37 ̊C with 5% CO2. miRNA mimics, inhibitor, agomir and small interfering RNA (siRNA). miR‐488‐3p mimics (forward, 5'‐UUG AAA GGc UAU UUc UUG GUc‐3' and reverse, 5'‐GAc cAA GAA AUA Gcc UUU cAA‐3'), miR‐488‐3p inhibitor (5'‐GAc cAA GAA AUA Gcc UUU cAA‐3'), miR‐488‐3p agomir (forward, 5'‐UUG AAA GGc UAU UUc UUG GUc‐3' and reverse, 5'‐GAc cAA GAA AUA Gcc UUU cAA‐3'), siRNAs targeting activin A receptor type 1c (AcVR1c) (si‐AcVR1c‐1; Forward, 5'‐GGG cUc cUU AUA UGA cUA UTT‐3' and reverse, 5'‐AUA GUc AUA UAA GGA Gcc cTT‐3'; si‐AcVR1c‐2: Forward, 5'‐GAG cUG Gcc AUc AUU AUU ATT‐3' and reverse, 5'‐UAA UAA UGA UGG ccA GcU cTT‐3'), negative control (Nc) mimics (forward, 5'‐UUG UAc UAc AcA AAA GUA cUG‐3', and reverse, 5'‐cAG UAc UUU UGU GUA GUA cAA‐3'), Nc inhibitor (5'‐cAG UAc UUU UGU GUA GUA cAA‐3'), Nc agomir (forward, 5'‐UUG UAc UAc AcA AAA GUA cUG‐3', and reverse, 5'‐cAG UAc UUU UGU GUA GUA cAA‐3'), and Nc siRNA (forward, 5'‐GcG AcG AUc UGc cUA AGA UdTdT‐3', and reverse, 5'‐AUc UUA GGc AGA UcG UcG cdTdT‐3') were obtained from Article Title: Integrated physiological, whole transcriptomic and functional analysis reveals the regulatory mechanism in the liver of rainbow trout (Oncorhynchus mykiss) in response to short-term and chronic hypoxia stress Article Snippet: The frequency of fish encountering hypoxia has risen dramatically as global warming and water pollution intensify, posing a serious threat to survival.. Rainbow trout (Oncorhynchus mykiss), which is an economically important fish worldwide, belongs to a typical hypoxia-sensitive fish.. However, little is known about the differences in response mechanisms employed by rainbow trout to short-term and chronic hypoxia stress and the roles of non-coding RNAs (ncRNAs) in the response of rainbow trout to hypoxia stress. Article Title: Desflurane alleviates LPS-induced acute lung injury by modulating let-7b-5p/HOXA9 axis. Article Snippet: Acute lung injury (ALI) is characterized by acute respiratory failure with tachypnea and widespread alveolar infiltrates, badly affecting patients’ health.. Desflurane (Des) is effective against lung injury.. However, its mechanism in ALI remains unknown. Article Title: The potential regulatory role of non-coding RNAs in mifepristone-induced masculinization in Takifugu rubripes gonads Article Snippet: The fru-miR-122 mimics (Sense 5’-3’ UGGAGUGUGACAAUGGUGUUUG, Antisense 5’-3’ AACACCAUUGUCACACUCCAUU) and the negative control (mimics-NC) (Sense 5’-3’ UUCUCCGAACGUGUCACGUTT, Antisense 5’-3’ ACGUGACACGUUCGGAGAATT) were designed and synthesized from GenePharma (Shanghai, China). |